Review



pcdna3 nano lantern ca2  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    TaKaRa pcdna3 nano lantern ca2
    Pcdna3 Nano Lantern Ca2, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+nano+lantern+ca2/pEF1alpha-mCherry-N1+Vector/pmc09701604__mmc4-186-88-82
    Average 96 stars, based on 10 article reviews
    pcdna3 nano lantern ca2 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Titration:

    Article Title: Optogenetic induction of hibernation-like state with modified human Opsin4 in mice
    Article Snippet: 50- AGTCGCCCCTACCCCGCCTACC GCGCCGCCCACCGCGCCGCCCTG GCCGCCCACGCCGCCAACCTCAG CTGGATCTCC-30 This paper N/A Forward primer for titration of AAV vectors 50- actgtgtttgctgacgcaac This paper N/A Reverse primer for titration of AAV vectors 50- agcgaaagtcccggaaag This paper N/A Recombinant DNA Plasmid: pAAV-EF1a-DIO-hM3Dq-mCherry Roth lab DREADDs (unpublished) Addgene #50460 Plasmid: pAAV-GFAP104-melanopsin-mCherry Mederos et al. (2020) Addgene #122630 Plasmid: pAAV-EF1a-DIO-hOPN4-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4dC-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-dC-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-mCherry-N1 Takara Bio Inc. Cat# 631969 Plasmid: pcDNA3-Nano-lantern(Ca2+)_600 Saito et al. (2012) Addgene #51982 Plasmid: pHelper Vector Takara Bio Inc. AAVpro Helper Free System Cat#6230 Plasmid: pGL4.3-NFAT-RE-luc2 Promega Corporation Cat# E8481 Software and algorithms PONEMAH Physiology Platform v.6.30 Data Sciences International. https://www.datasci.com/ InfReC Analyzer NS9500 Professional Nippon Avionics https://www.avio.co.jp/ GraphPad Prism 9 GraphPad http://Graphpad.com/ MATLAB Mathworks http://Mathworks.com/ Leica Application Suite X Life Science Leica https://www.leica-microsystems.com/ IGOR Pro version 6.0 WaveMetrics https://www.wavemetrics.com/ Fiji/ImageJ Schindelin et al. (2012) https://fiji.sc/ R The R Foundation https://www.r-project.org/ Other Thermostatic chamber SHINFACTORY HC-100 optic cannula KYOCERA Corporation F0617S02A4PW060 Article ll OPEN ACCESS

    Recombinant:

    Article Title: Optogenetic induction of hibernation-like state with modified human Opsin4 in mice
    Article Snippet: 50- AGTCGCCCCTACCCCGCCTACC GCGCCGCCCACCGCGCCGCCCTG GCCGCCCACGCCGCCAACCTCAG CTGGATCTCC-30 This paper N/A Forward primer for titration of AAV vectors 50- actgtgtttgctgacgcaac This paper N/A Reverse primer for titration of AAV vectors 50- agcgaaagtcccggaaag This paper N/A Recombinant DNA Plasmid: pAAV-EF1a-DIO-hM3Dq-mCherry Roth lab DREADDs (unpublished) Addgene #50460 Plasmid: pAAV-GFAP104-melanopsin-mCherry Mederos et al. (2020) Addgene #122630 Plasmid: pAAV-EF1a-DIO-hOPN4-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4dC-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-dC-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-mCherry-N1 Takara Bio Inc. Cat# 631969 Plasmid: pcDNA3-Nano-lantern(Ca2+)_600 Saito et al. (2012) Addgene #51982 Plasmid: pHelper Vector Takara Bio Inc. AAVpro Helper Free System Cat#6230 Plasmid: pGL4.3-NFAT-RE-luc2 Promega Corporation Cat# E8481 Software and algorithms PONEMAH Physiology Platform v.6.30 Data Sciences International. https://www.datasci.com/ InfReC Analyzer NS9500 Professional Nippon Avionics https://www.avio.co.jp/ GraphPad Prism 9 GraphPad http://Graphpad.com/ MATLAB Mathworks http://Mathworks.com/ Leica Application Suite X Life Science Leica https://www.leica-microsystems.com/ IGOR Pro version 6.0 WaveMetrics https://www.wavemetrics.com/ Fiji/ImageJ Schindelin et al. (2012) https://fiji.sc/ R The R Foundation https://www.r-project.org/ Other Thermostatic chamber SHINFACTORY HC-100 optic cannula KYOCERA Corporation F0617S02A4PW060 Article ll OPEN ACCESS

    Plasmid Preparation:

    Article Title: Optogenetic induction of hibernation-like state with modified human Opsin4 in mice
    Article Snippet: 50- AGTCGCCCCTACCCCGCCTACC GCGCCGCCCACCGCGCCGCCCTG GCCGCCCACGCCGCCAACCTCAG CTGGATCTCC-30 This paper N/A Forward primer for titration of AAV vectors 50- actgtgtttgctgacgcaac This paper N/A Reverse primer for titration of AAV vectors 50- agcgaaagtcccggaaag This paper N/A Recombinant DNA Plasmid: pAAV-EF1a-DIO-hM3Dq-mCherry Roth lab DREADDs (unpublished) Addgene #50460 Plasmid: pAAV-GFAP104-melanopsin-mCherry Mederos et al. (2020) Addgene #122630 Plasmid: pAAV-EF1a-DIO-hOPN4-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4dC-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-dC-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-mCherry-N1 Takara Bio Inc. Cat# 631969 Plasmid: pcDNA3-Nano-lantern(Ca2+)_600 Saito et al. (2012) Addgene #51982 Plasmid: pHelper Vector Takara Bio Inc. AAVpro Helper Free System Cat#6230 Plasmid: pGL4.3-NFAT-RE-luc2 Promega Corporation Cat# E8481 Software and algorithms PONEMAH Physiology Platform v.6.30 Data Sciences International. https://www.datasci.com/ InfReC Analyzer NS9500 Professional Nippon Avionics https://www.avio.co.jp/ GraphPad Prism 9 GraphPad http://Graphpad.com/ MATLAB Mathworks http://Mathworks.com/ Leica Application Suite X Life Science Leica https://www.leica-microsystems.com/ IGOR Pro version 6.0 WaveMetrics https://www.wavemetrics.com/ Fiji/ImageJ Schindelin et al. (2012) https://fiji.sc/ R The R Foundation https://www.r-project.org/ Other Thermostatic chamber SHINFACTORY HC-100 optic cannula KYOCERA Corporation F0617S02A4PW060 Article ll OPEN ACCESS

    Software:

    Article Title: Optogenetic induction of hibernation-like state with modified human Opsin4 in mice
    Article Snippet: 50- AGTCGCCCCTACCCCGCCTACC GCGCCGCCCACCGCGCCGCCCTG GCCGCCCACGCCGCCAACCTCAG CTGGATCTCC-30 This paper N/A Forward primer for titration of AAV vectors 50- actgtgtttgctgacgcaac This paper N/A Reverse primer for titration of AAV vectors 50- agcgaaagtcccggaaag This paper N/A Recombinant DNA Plasmid: pAAV-EF1a-DIO-hM3Dq-mCherry Roth lab DREADDs (unpublished) Addgene #50460 Plasmid: pAAV-GFAP104-melanopsin-mCherry Mederos et al. (2020) Addgene #122630 Plasmid: pAAV-EF1a-DIO-hOPN4-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4dC-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-mCherry This paper N/A Plasmid: pAAV-EF1a-DIO-hOPN4-9A-dC-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-EF1a-hOPN4-mCherry This paper N/A Plasmid: pEF1a-mCherry-N1 Takara Bio Inc. Cat# 631969 Plasmid: pcDNA3-Nano-lantern(Ca2+)_600 Saito et al. (2012) Addgene #51982 Plasmid: pHelper Vector Takara Bio Inc. AAVpro Helper Free System Cat#6230 Plasmid: pGL4.3-NFAT-RE-luc2 Promega Corporation Cat# E8481 Software and algorithms PONEMAH Physiology Platform v.6.30 Data Sciences International. https://www.datasci.com/ InfReC Analyzer NS9500 Professional Nippon Avionics https://www.avio.co.jp/ GraphPad Prism 9 GraphPad http://Graphpad.com/ MATLAB Mathworks http://Mathworks.com/ Leica Application Suite X Life Science Leica https://www.leica-microsystems.com/ IGOR Pro version 6.0 WaveMetrics https://www.wavemetrics.com/ Fiji/ImageJ Schindelin et al. (2012) https://fiji.sc/ R The R Foundation https://www.r-project.org/ Other Thermostatic chamber SHINFACTORY HC-100 optic cannula KYOCERA Corporation F0617S02A4PW060 Article ll OPEN ACCESS



    Similar Products

    pcdna3 nano lantern ca2  (TaKaRa)
    96
    TaKaRa pcdna3 nano lantern ca2
    Pcdna3 Nano Lantern Ca2, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+nano+lantern+ca2/pEF1alpha-mCherry-N1+Vector/pmc09701604__mmc4-186-88-82
    Average 96 stars, based on 1 article reviews
    pcdna3 nano lantern ca2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    pcdna3 nano lantern ca2  (Addgene inc)
    91
    Addgene inc pcdna3 nano lantern ca2
    Pcdna3 Nano Lantern Ca2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+nano+lantern+ca2/Nano-lantern(Ca2%2B)_63%2FpcDNA3+(Plasmid+%2351986)/pm36452866-184-88-93
    Average 91 stars, based on 1 article reviews
    pcdna3 nano lantern ca2 - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier
    plasmid  (Addgene inc)
    90
    Addgene inc plasmid
    Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+nano+lantern+ca2/Nano-lantern(Ca2%2B)_150%2FpcDNA3+(Plasmid+%2351984)/pmc09701604-76-0-8
    Average 90 stars, based on 1 article reviews
    plasmid - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    expression constructs pef1a hopn4s mcherry  (Addgene inc)
    91
    Addgene inc expression constructs pef1a hopn4s mcherry
    Light stimulation was applied to Qrfp-iCre mouse expressing hOPN4dC-mCherry in the AVPe via an optic fiber (3 μW from the fiber tip, 473-nm, 6 h from time 0). Heart rate and core body temperature are also simultaneously taken by telemetry sensors. Video plays at 60x speed. Images in Figure 1D are created from this video.
    Expression Constructs Pef1a Hopn4s Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+nano+lantern+ca2/Nano-lantern(Ca2%2B)_600%2FpcDNA3+(Plasmid+%2351982)/pmc09701604-468-34-39
    Average 91 stars, based on 1 article reviews
    expression constructs pef1a hopn4s mcherry - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier
    saito  (Addgene inc)
    91
    Addgene inc saito

    Saito, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+nano+lantern+ca2/Nano-lantern(Ca2%2B)_600%2FpcDNA3+(Plasmid+%2351982)/pmc09701604-76-3-8
    Average 91 stars, based on 1 article reviews
    saito - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier
    nano lantern ca2 600  (Addgene inc)
    91
    Addgene inc nano lantern ca2 600

    Nano Lantern Ca2 600, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna3+nano+lantern+ca2/Nano-lantern(Ca2%2B)_600%2FpcDNA3+(Plasmid+%2351982)/pm25445178-157-37-40
    Average 91 stars, based on 1 article reviews
    nano lantern ca2 600 - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier

    Image Search Results


    Light stimulation was applied to Qrfp-iCre mouse expressing hOPN4dC-mCherry in the AVPe via an optic fiber (3 μW from the fiber tip, 473-nm, 6 h from time 0). Heart rate and core body temperature are also simultaneously taken by telemetry sensors. Video plays at 60x speed. Images in Figure 1D are created from this video.

    Journal: Cell Reports Methods

    Article Title: Optogenetic induction of hibernation-like state with modified human Opsin4 in mice

    doi: 10.1016/j.crmeth.2022.100336

    Figure Lengend Snippet: Light stimulation was applied to Qrfp-iCre mouse expressing hOPN4dC-mCherry in the AVPe via an optic fiber (3 μW from the fiber tip, 473-nm, 6 h from time 0). Heart rate and core body temperature are also simultaneously taken by telemetry sensors. Video plays at 60x speed. Images in Figure 1D are created from this video.

    Article Snippet: Stimulating light for hOPN4s and excitation light for fluorescence were the same (480 nm, 500 ms, every 2 s), as described in a previous study., For bioluminescence-based Ca2+ recording, cells were transfected with the expression constructs pEF1a-hOPN4s-mCherry and pcDNA3-Nano-lantern(Ca2+)_600 (Addgene, #51982 ).

    Techniques:

    Representative thermal and visual imaging of a Qrfp-iCre mouse expressing hOPN4dC-mCherry in the AVPe, during optogenetic stimulation via a blue LED attached on the skull (250 μW, 1 h from time 0). Core body temperature was simultaneously taken by telemetry system. Video plays at 60x speed. Images in Figure 4B are created from this video.

    Journal: Cell Reports Methods

    Article Title: Optogenetic induction of hibernation-like state with modified human Opsin4 in mice

    doi: 10.1016/j.crmeth.2022.100336

    Figure Lengend Snippet: Representative thermal and visual imaging of a Qrfp-iCre mouse expressing hOPN4dC-mCherry in the AVPe, during optogenetic stimulation via a blue LED attached on the skull (250 μW, 1 h from time 0). Core body temperature was simultaneously taken by telemetry system. Video plays at 60x speed. Images in Figure 4B are created from this video.

    Article Snippet: Stimulating light for hOPN4s and excitation light for fluorescence were the same (480 nm, 500 ms, every 2 s), as described in a previous study., For bioluminescence-based Ca2+ recording, cells were transfected with the expression constructs pEF1a-hOPN4s-mCherry and pcDNA3-Nano-lantern(Ca2+)_600 (Addgene, #51982 ).

    Techniques:

    Journal: Cell Reports Methods

    Article Title: Optogenetic induction of hibernation-like state with modified human Opsin4 in mice

    doi: 10.1016/j.crmeth.2022.100336

    Figure Lengend Snippet:

    Article Snippet: Plasmid: pcDNA3-Nano-lantern(Ca2+)_600 , Saito et al. (2012) , Addgene #51982.

    Techniques: Virus, Recombinant, Transfection, Modification, Cloning, Synthesized, Titration, Plasmid Preparation, Software